ZooKeys | 148: 65-78 (2023) A peer-reviewed open-access journal Gs ROAD tees #ZooKeys https:/ / ZOO keys. pensoft.net Launched to accelerate biodiversity research A new species of Diglyphus Walker (Hymenoptera, Eulophidae) from China, with morphological characterizations and molecular analysis Wei-Jie Wan!', Su-Jie Du', Christer Hansson??, Wan-Xue Liu! I State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, 100193, China 2 Biological Museum (Entomology), Lund University, Sdlvegatan 37, SE-22362 Lund, Sweden 3 Natural History Museum, Life Sciences, Cromwell Road, London, UK Corresponding author: Wan-Xue Liu (liuwanxue@caas.cn) Academiceditor: Zachary Lahey | Received 14 December 2022 | Accepted 26 January 2023 | Published 15 February 2023 Attps://zoobank. org/526E2D0A-EFBE-49D8-9C90-83978808D3BA Citation: Wan W-J, Du S-J, Hansson C, Liu W-X (2023) A new species of Diglyphus Walker (Hymenoptera, Eulophidae) from China, with morphological characterizations and molecular analysis. ZooKeys 1148: 65-78. https:// doi.org/10.3897/zookeys.1148.98853 Abstract Diglyphus Walker, 1844 (Hymenoptera: Eulophidae) is an economically important genus including spe- cies acting as biocontrol agents against agromyzid leafminer pests. A new species of Diglyphus, Diglyphus difasciatus Liu, Hansson & Wan, sp. nov., was discovered during the identification of agromyzid leafmin- ers and their associated parasitoid wasps collected from 2016 to 2022 in China, based on morphological characteristics and molecular analyses of COI, ITS2 and 28S genes. Diglyphus difasciatus is similar to D. bimaculatus Zhu, LaSalle & Huang, distinguished by two interconnected infuscate vertical bands on the fore wing and the color of the scape. Molecular data support D. difasciatus and D. bimaculatus as two different species. The mean genetic distances between D. difasciatus and D. bimaculatus were 11.33%, 8.62%, and 0.18%, based on the COI, ITS2, and 28S genes, respectively. Keywords 28S, Agromyzidae, biology, COI, ITS2, occurrence, parasitic wasp, phylogeny, taxonomy Copyright Wei-Jie Wan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 66 Wei-Jie Wan et al. / ZooKeys 1148: 65-78 (2023) Introduction The genus Diglyphus (Hymenoptera: Eulophidae) was described by Walker (1844). Many taxonomists worldwide have summarized the typical Diglyphus morphological characteristics and introduced new Diglyphus species (Gordh and Hendrickson 1979; Zhu et al. 2000; Yefremova 2007; Hansson and Navone 2017). Diglyphus currently includes 41 species, and 17 of these are recorded from China (Gordh and Hendrickson 1979; Gauthier et al. 2000; Zhu et al. 2000; Liu et al. 2013; Hansson and Navone 2017; Ye et al. 2018; Noyes 2019). Diglyphus is an economically important genus containing species that attack Agro- myzidae (Diptera) leafminers and occasionally Lepidoptera pests (Gelechiidae, Gracil- lariidae, Lyonetiidae, and Nepticulidae) (Zhu et al. 2000; Yefremova et al. 2011; Hans- son and Navone 2017; Noyes 2019). Agromyzidae leafminers such as Chromatomyia horticola (Goureau) and Liriomyza spp. are pests of vegetables and ornamental plants worldwide (Bader et al. 2006; Kaspi and Parrella 2006; Foba et al. 2016; Rajender and Sharma 2016). Identification of Diglyphus species mainly depends on morphological data. How- ever, combining analyses of the morphology with molecular data for species identifica- tion is essential owing to the morphological similarities among species (Bernardo et al. 2008; Gebiola et al. 2012; Hansson and Navone 2017; Ye et al. 2018). The cytochrome c oxidase I (COI) gene of the mitochondrial DNA and internal transcribed spacer II (ITS2) ribosomal DNA genes have previously been applied to enhance species identi- fication (Hebert et al. 2003; Bernardo et al. 2008; Gebiola et al. 2009; Gebiola et al. 2012; Gebiola et al. 2015; Du et al. 2021). Although 28S ribosomal DNA (28S) has mostly used for phylogenetic studies at the genus level and above, it has also been used for species identification (Gauthier et al. 2000; Gebiola et al. 2009; Burks et al. 2011; Gebiola et al. 2015). For this project we collected Diglyphus material from 33 sites in China during 2016 to 2022 (Fig. 11). The specimens were reared mainly from the agromyzid Chromatomyia horticola (Table 1). An undescribed species of Diglyphus, D. difasciatus Liu, Hansson & Wan, was discovered during the identification of the reared material. Altogether we recovered 125 female and 153 male specimens of D. difasciatus (Table 1). Materials and methods Sampling We collected the leaves of vegetables and ornamental plants infested with agromyzid leafminers in different provinces of China from 2016 to 2022. The leaves were placed in cages and each cage was labeled with collection date, locality, and host plant. The collected leaf material was maintained in climate chambers set at 25 + 1 °C, 30— 50% relative humidity, and a photoperiod of 14:10 h (light: dark) until agromyzid A new species of Diglyphus Walker from China 67 leafminers and their parasitoids emerged. All wasp specimens and their hosts were pre- served in absolute ethanol and maintained at -20 °C at the Institute of Plant Protection (IPP), Chinese Academy of Agricultural Sciences (CAAS), Beijing, China. All data for D. difasciatus specimens are presented in Table 1. Two males and two females of D. difasciatus reared from C. horticola were imaged and morphologically characterized. One male and one female (the holotype) were reared from leaves of Lactuca sativa Linn. and Brassica rapa var. glabra Regel in Hebei, China; one female was reared from leaves of Sonchus oleraceus Regel in Gansu, China; one male was reared from leaves of L. sativa in Hebei, China. Two female and one male of D. bimaculatus Zhu, LaSalle & Huang were used for imaging and morphological characterization, which were reared from leaves of Sonchus oleraceus in Tibet, China. Specimens used for molecular analyses included 67 specimens of D. difasciatus, 19 D. bimaculatus (Tibet), and 19 D. isaea (Walker) (Hubei). Diglyphus bimaculatus and D. isaea sequences were used as outgroups for analyzing the phylogenetic relationship of D. difasciatus. Furthermore, one female of D. bimaculatus used for molecular analyses was reared from leaves of Taraxacum mongolicum Hand.-Mazz., which was collected from Tibet, China (29°39'3"N, 91°08'41"E) in August 2020. The single D. isaea specimen was reared from C. horticola in Pisum sativum Linn. leaves, collected in Hubei, China (30°28'26"N, 114°21'17"E) in April 2017. Morphological identification methods The specimens were examined using a stereomicroscope (Olympus, SZX-16). Pho- tographs were taken using an Olympus BX43 microscope equipped with a Helicon Focus 6. The morphological terminology and measurement methods follow Gibson (1989), Hansson (1990), and Yefremova et al. (2011), and the following abbreviations were used: F1-2 Flagellomeres 1-2: maximum length of flagellomeres 1-2. OOL = Ocular ocellar line: shortest distance between the lateral ocelli and eyes. POL Posterior ocellar line: shortest distance between lateral ocelli. Molecular diagnosis methods Genomic DNA was extracted from the metasoma of each specimen. The extraction methods followed those described by De Barro and Driver (1997), with some modi- fications. The DNA extraction was performed using a 200-uL microcentrifuge tube (Bioevopeak, Shandong, China) and 200-yL pipette tip (Bioevopeak) sealed by heat- ing to grind the metasoma into a homogenate. The homogenate was incubated at 65 °C, 25 °C, and 96 °C for 30, 2, and 10 min, respectively. After extraction, the genomic DNA was stored at -20 °C until molecular diagnosis. The primers used for amplification were in Table 2. 68 Wei-Jie Wan et al. / ZooKeys 1148: 65-78 (2023) Table |. Collecting information of Diglyphus difasciatus sp. nov. specimens. Specimens 52,25 (49) 19 72,16 1d 1d 192 (19) 12-2) 1d 19,13 19 14 (10) 29, 43 (18) 12 19,33 33 ' (20) 12726: 33 192 1d 62, 3d (39) 29,20 29, 25 (19, 13) 19 29, 23 (19, 1d) 33 32 (29) 39,53 (22, 18) 62, 124 (29, 3d) 52; 34 (29, 10) 29, 23 (1d) 49,233 (19,10) 59,34 (29, 10) 29 1d (1d) 23 1d 52; 65 1 (1d) 42 (29) 52 (39) 89, 144 (32, 33) 49,23 (29, 10) 1d 2¢ (19) Sampling locality Longnan, Gansu Baiyin, Gansu Chifeng, Inner Mongolia Guyuan, Ningxia Guyuan, Ningxia Gonghe, Qinghai Baoji, Shaanxi Baoji, Shaanxi Yantai, Shandong Rizhao, Shandong Linyi, Shandong Xinzhou, Shanxi Xinzhou, Shanxi Xinzhou, Shanxi Linfen, Shanxi Xinzhou, Shanxi Xinzhou, Shanxi Xinzhou, Shanxi Xinzhou, Shanxi Xinzhou, Shanxi Xinzhou, Shanxi Changzhi, Shanxi Changzhi, Shanxi Yangquan, Shanxi Xinzhou, Shanxi Xinzhou, Shanxi Jincheng, Shanxi Jincheng, Shanxi Jincheng, Shanxi Beijing Beijing Beijing Beijing Beijing Beijing Beijing Beijing Beijing Beijing Beijing Beijing Beijing Beijing Shijiazhuang, Hebei GPS coordinates 33°23'58"N, 104°49'39"E 36°32'4"N, 104°10'21"E 42°02'50"N, 120°23'25"E 36°01'31"N, 106°12'41"E 36°01'31"N, 106°12'41"E 36°16'35"N, 100°34'13"E 34°19'41"N, 107°13'56"E 34°19'41"N, 107°13'56"E 37°17'26"N, 121°33'46"E 35°17'29"N, 119°11'37"E 35°50'11"N, 118°28'56"E 39°11'23"N, 113°15'14"E 39°11'23"N, 113°15'14"E 39°11'23"N, 113°15'14"E 36°04'30"N, 111°30'5"E 39°11'23"N, 113°15'14"E 39°11'36"N, 113°16'27"E 39°11'36"N, 113°16'27"E 39°11'36"N, 113°16'27"E 39°11'36"N, 113°16'27"E 39°11'12"N, 113°14'30"E 36°11'8"N, 113°04'22"E 36°11'8"N, 113°04'22"E 38°05'37"N, 113°22'45"E 39°10'33"N, 113°17'35"E 39°10'33"N, 113°17'35"E 35°29'33"N, 112°54'16"E 35°29'33"N, 112°54'16"E 35°29'33"N, 112°54'16"E 40°01'22"N, 116°17'9"E 40°39'35"N, 117°13'55"E 40°39'35"N, 117°13'55"E 40°08'41"N, 116°45'36"E 40°08'41"N, 116°45'36"E 39°36'18"N, 116°18'57"E 40°01'17"N, 116°17'15"E 40°01'34"N, 116°16'51"E 40°16'21"N, 116°13'30"E 39°52'32"N, 116°11'21"E 39°36'18"N, 116°18'57"E 40°01'23"N, 116°17'9"E 40°01'23"N, 116°17'9"E 40°11'28"N, 116°28'0"E 37°51'27"N, 114°32'12"E Host plants Sonchus oleraceus Phaseolus vulgaris Phaseolus vulgaris Raphanus sativus Sonchus oleraceus Sonchus oleraceus Chrysanthemum morifolium Glebionis coronaria Sonchus oleraceus Phaseolus vulgaris Brassica napus Lepidium apetalum Alcea rosea Brassicaceae sp. Pisum sativum Lepidium apetalum Sonchus oleraceus Cirsium arvense vat. integrifolium Sonchus oleraceus Asteraceae sp. Lepidium apetalum Cirsium japonicum Taraxacum mongolicum Alcea rosea Asteraceae sp. Asteraceae sp. Lepidium apetalum Crepidiastrum sonchifolium Lxeris polycephala Glebionis coronaria Raphanus sativus Pisum sativum Glebionis coronaria Glebionis coronaria Lxeris polycephala Phaseolus vulgaris Crepidiastrum sonchifolium Lactuca sativa vat. asparagina Lxeris polycephala Hemisteptia lyrata Crepidiastrum sonchifolium Lxeris polycephala Luffa aegyptiaca Lxeris polycephala Host C. horticola L. sativae Unknown C. horticola and L. huidobrensis C. horticola C. horticola Unknown Unknown Unknown L. sativae C. horticola C. horticola C. horticola C. horticola and L. bryoniae C. horticola and L. trifolii C. horticola C. horticola C. horticola and L. bryoniae Unknown Unknown C. horticola C. horticola C. horticola C. horticola C. horticola C. horticola and L. Sativae C. horticola C. horticola C. horticola C. horticola C. horticola, L. bryoniae and L. sativae C. horticola C. horticola C. horticola C. horticola and L. bryoniae C. horticola C. horticola C. horticola C. horticola C. horticola and L. sativae C. horticola C. horticola and L. bryoniae Unknown C. horticola Sampling date 2019.05 2018.09 2018.08 2018.09 2018.09 2018.07 2019.05 2019.05 2017.05 2018.10 2019.05 2017.06 2017.06 2017.06 2017.06 2017.06 2017.07 2017.07 2017.07 2017.07 2018.05 2018.05 2018.05 2018.05 2018.05 2018.09 2019.05 2019.05 2019.05 2016.05 2016.06 2016.06 2017.05 2017.05 2017.05 2017.08 2018.05 2018.05 2019.05 2019.05 2019.05 2019.05 2019.08 2017.05 A new species of Diglyphus Walker from China 69 Specimens Sampling locality GPS coordinates Host plants Host Sampling date 39,13 (29) Shijiazhuang, Hebei 38°16'48"N, 114°41'59"E Asteraceae sp. C. horticola 2017.05 12 (19) Shijiazhuang, Hebei 40°45'38"N, 114°51'32"E Lepidium apetalum Unknown 2018.06 39,53 Shijiazhuang, Hebei 41°09'11"N, 114°03'40"E Sonchus oleraceus C. horticola 2018.07 82, 108 Shijiazhuang, Hebei 41°09'11"N, 114°03'40"E Pisum sativum C. horticola 2018.07 12 (19) Shijiazhuang, Hebei 41°09'11"N, 114°03'40"E — Lactuca sativa var. asparagina —_—C-. horticola 2018.07 69,73 Shijiazhuang, Hebei 41°14'30"N, 114°09'25"E Lactuca sativa C. horticolaand L. 2018.08 bryoniae 52, 144 (39,4) Zhangjiakou, Hebei 41°14'30"N, 114°09'25"E Lactuca sativa C. horticola 2018.08 19 (19) Zhangjiakou, Hebei 41°24'30"N, 114°09'8"E Taraxacum mongolicum C. horticola 2019.07 2¢ (23) Zhangjiakou, Hebei 41°24'30"N, 114°09'8"E Pisum sativum C. horticola 2019.07 19 Zhangjiakou, Hebei 41°24'30"N, 114°09'8"E Asteraceae sp. C. horticola 2019.08 29,23 Zhangjiakou, Hebei 41°09'11"N, 114°03'40"E — Lactuca sativa and Brassica C. horticola 2022.08 rapa vat. glabra Note: The number and sex of molecular identification specimens were in brackets. Table 2. Primers used for amplification. Gene Primers Sequences (5’-3’) References COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994 HCO2198 TAAACT TCAGGGTGACCAAAAAATCA Folmer et al. 1994 ITS2 ITS2F TGTGAACTGCAGGACACATG Campbell et al. 1993 ITS2R AATGCTTAAATT TAGGGGGTA Campbell et al. 1993 28S D2-3549F AGTCGTGTTGCTTGATAGTGCAG Campbell et al. 1993 D2-4068R TIGGTCCGTGTTTCAAGACGGG Campbell et al. 1993 Amplifications were performed as described by Hebert et al. (2003) and Du et al. (2021). Polymerase chain reaction (PCR) consisted of 0.4 uL Zag enzyme (2.5 UpL"), 0.4 uL deoxynucleotide triphosphate (2.5 mM), 2.5 uL 10x buffer (containing Mg”*), 0.4 uL forward primer, 0.4 uL reverse primer, 1 »L DNA template, and 19.9 pL double-distilled H,O. Next, the PCR cycling conditions consisted of an initial dena- turation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing for 45 s, extension at 72 °C for 60 s, and a single cycle of final extension at 72 °C for 5 min. The annealing temperatures for the COI, ITS2, and 28S genes were 50 °C, 52 °C, and 58 °C, respectively. The unpurified PCR products were sent to Sangon Biotech Co., Ltd, Beijing, Chi- na, for bidirectional sequencing, and primers were designed by Sangon Biotech Co., Ltd, Beijing, China. The PCR instrument used was an ABI thermal cycler (Applied Biosystems Veriti 9902; Woburn, MA, USA). Sequence analysis The D. difasciatus sequences were analyzed using the National Center for Biotechnolo- gy Information (NCBI, https://www.ncbi.nlm.nih.gov/) and the Barcode of Life Data systems (BOLD, http://www.boldsystems.org/index.php). The phylogenetic relation- ships between D. difasciatus, D. bimaculatus, and D. isaea were also analyzed. 70 Wei-Jie Wan et al. / ZooKeys 1148: 65-78 (2023) All sequences were aligned following the default options of the CLUSTAL W tool (Kimura 1980); in Molecular Evolutionary Genetics Analysis (MEGA) X ver. 10.1.8 (Kimura 1980; Kumar et al. 2018). Pairwise and mean sequence divergence were es- timated based on the Kimura-2 parameter (K2-P) (Kimura 1980). Gene haplotypes were calculated using DNA sequence polymorphism ver. 5 (Bioinformatics, Arlington, VA, USA) (Librado and Rozas 2009). The phylogenetic tree was constructed using the Neighbor-Joining method in MEGA X (Kimura 1980; Nei and Kumar 2000; Kumar et al. 2018). Bootstrap values were obtained after 1000 replications for sequence di- vergence and phylogenetic relationships. Bootstrap support values >75% is indicated above the branches of the phylogenetic tree. Results Taxonomy Diglyphus difasciatus Liu, Hansson & Wan, sp. nov. https://zoobank.org/DA7567 18-6C6B-4958-8375-BED 1 BFOGEE3C Figs 1-7 Material. Holotype female: Cuina, Hebei; 41°09'11"N, 114°03'40"E; 25 August 2022; Miao-Miao Mao leg.; reared from Chromatomyia horticola on leaves of Lactuca sativa and Brassica rapa var. glabra, deposited in IPP. Paratypes: 12 23 with same label data as holotype, deposited in National Animal Collection Resource Center, In- stitute of Zoology, Chinese Academy of Sciences. 12 Curna, Beijing; 39°52'32"N, 116°11'21"E; 11 May 2019; Qiang Wu leg.; reared from C. horticola on leaves of Sonchus oleraceus and Ixeris polycephala, deposited in National Animal Collection Re- source Center, Institute of Zoology, Chinese Academy of Sciences. 22: Cuina, Bei- jing; 39°36'18"N, 116°18'57"E; 20 May 2019; Jing He and Meng Guo leg.; reared from C. horticola on leaves of Hemisteptia lyrata, deposited in IPP. 19 24 Cura, Shanxi; 39°11'23"N, 113°15'14"E; 6 June 2017; Zhu-Sheng Zheng leg.; reared from C. horticola on leaves of Lepidium apetalum, deposited in IPP. 19 24 Cutna, Shanxi; 36°11'8"N, 113°04'22"E; 17 May 2018; Jing He and Su-Jie Du leg.; reared from C. horticola on leaves of Cirsium japonicum, deposited in IPP. 39 53 Cura, Shanxi; 35°29'33"N, 112°54'16"E; 9 May 2019; Jing He and Su-Jie Du leg.; reared from C. horticola on leaves of Crepidiastrum sonchifolium, deposited in IPP. 22 14 Cntna, Hebei; 38°16'48"N, 114°41'59"E; 14 May 2017; Rong-Jun Zhen and Gui-Fen Zhang leg.; reared from C. horticola on leaves of an unidentified Asteraceae, deposited in IPP. Diagnosis. Scape white with apical 1/3-1/2 dark brown (Figs 1-5). The yellow markings on the vertex and face, and those on the male are wider than those on the female. Fore wing with complete vertical infuscate bands below base of marginal and stigmal veins respectively, the two bands are interconnected medially (Figs 1-3, 7); speculum bare, without dense setae and postmarginal vein almost equal in length to A new species of Diglyphus Walker from China 71 [—— | cn £4 ma» Figures 1-2. Diglyphus difasciatus sp. nov. | female holotype, habitus, dorsal view 2 male paratype, habitus, dorsal view. stigmal vein (Figs 1-3, 7). Mid and hind femora black with apical 1/4 yellowish-white (Figs 1-3). Fore and mid tibia yellowish-white with a dark ring basally (Figs 1-3). Hind tibia black with apical 1/5 yellowish-white (Figs 1-3). Pretarsus on all legs black (Figs 1-3). Description. Female (Fig. 1). Body length 1.6mm, Fore wing length 0.8mm. Scape white with apical 1/3—1/2 dark brown. Pedicel and flagellum dark brown. Head dark brown. Eyes red and ocelli brown. Mandibles brownish. Yellow markings on the vertex and face. Pronotum, mesoscutum, scutellum, dorsellum, and propodeum me- tallic blue-green. Fore wing with two complete vertical infuscate bands below base of marginal and stigmal veins respectively, the two bands are interconnected medially (Fig. 7). Mid and hind femora black with apical 1/4 yellowish-white. Fore and mid tibia yellowish-white with a dark ring basally. Hind tibia black with apical 1/5 yellow- ish-white. Gaster dark brown. Head (Fig. 1). Head length 0.6x width in dorsal view, and length 0.9x width in frontal view. POL 1.8x OOL. Malar space 0.7x height of eye, and malar sulcus present. Frons and vertex with distinct reticulation. Eyes with sparse and short setae. Toruli situated below the level of lower margin of eyes. Maxillary palpus with two segments and labial palpus with one segment. Antennal flagellum with two funiculars and three clavomeres; scape 4.0x as long as broad and 2.8x as long as pedicel; pedicel 1.3x as long as broad; Fl 1.4x and F2 0.9x as long as broad, F1 1.5x as long as F2; clava 2.4x as long as broad, 1.3x as long as scape, and 3.6x as long as F2. Mesosoma (Fig. 1). Pronotum without transverse carina, reticulate, shorter than mesoscutum. Mesoscutum 1.2x as long as scutellum; mid lobe with two pairs of long setae; notauli incomplete and diverging posteriorly to meet anterior part of axillae. Setae on pronotum and mesoscutum pale. Scutellum as long as broad with straight sublateral grooves and two pairs of setae. Dorsellum with superficial reticulation with isodiametric meshes, posterior margin round. Propodeum shorter than scutellum and 7D Wei-Jie Wan et al. / ZooKeys 1148: 65-78 (2023) 0.1 mm 0.1mm 8 Figures 3-8. Diglyphus spp. 3-7 D. difasciatus sp. nov. 3 female paratype, habitus, lateral view 4 female paratype, antenna, lateral view 5 male paratype, head, lateral view 6 male paratype, mesosoma, dorsal view 7 female holotype, left fore and hind wings, dorsal view 8 D. bimaculatus Zhu, LaSalle & Huang, female, left fore and hind wings, dorsal view. without median carina; callus with five setae. Fore wing with 5—7 setae on dorsal sur- face of submarginal vein; speculum mainly bare, with few scattered setae; costal cell with two rows of setae, including 15 setae at the base of costal cell and an incomplete row with eight setae in apical part; postmarginal vein almost equal in length to stigmal vein; Fore wing length 1.7x fore wing width. Petiole short and inconspicuous. Gaster subrotund, 1.9x as long as wide in dorsal view; apex acute. Tip of ovipositor sheaths visible in dorsal view. A new species of Diglyphus Walker from China 73 Male (Fig. 2). Similar to the female. Body length 1.4mm, Fore wing length 0.8mm. Head length 0.5x width in dorsal view, and length 0.8x width in frontal view. POL 1.1x OOL. Scape 4.7x as long as broad, 2.2x as long as pedicel. Pedicel 1.6x as long as broad. Antennal flagellum with two funiculars and three clavomeres, F1 0.8x and F2 0.7x as long as broad, F1 1.2x as long as F2. Clava 3.1x as long as broad, 1.1x as long as scape and 4.6x as long as F2. Mesoscutum 1.2x as long as scutellum. Scutellum as long as broad. Fore wing length 1.7x as long as fore wing width. Gaster 1.8x as long as wide in dorsal view. Variation. Females are slightly larger than males (1.6 mm and 1.4 mm, respectively). Hosts and biology. Diglyphus difasciatus is a larval ectoparasitoid, primarily on Chromatomyia horticola, and occasionally on Liriomyza bryoniae (Kaltenbach), L. sativae, and L. trifolii (Burgess). The hosts are usually mining in leaves of Asteraceae, Brassicaceae and Fabaceae, especially on Jxeris polycephala Cass. ex DC. and Pisum sativum (Table 1). Diglyphus difasciatus occurs and reaches its highest occurrence period in May, and then disappears in October. Female Diglyphus exhibit three types of host-killing behavior (Zhu et al. 2000; Liu et al. 2013; Hansson and Navone 2017; Ye et al. 2018). The host-killing behavior of D. difasciatus is not known and requires further studies. Distribution. China (Beijing, Gansu, Hebei, Inner Mongolia, Ningxia, Qinghai, Shaanxi, Shandong, and Shanxi). Etymology. The name is derived from a combination of the Latin di (double) and fascia (band) by referring to the two vertical infuscate bands in the fore wings. Comments. Diglyphus difasciatus is very similar to D. bimaculatus (Figs 8-10), but has two complete vertical infuscate bands that are interconnected medially in the fore wing, whereas D. bimaculatus has two infuscate spots in the fore wing. In addition, the scape of D. difasciatus is white with apical 1/3-1/2 dark brown (Figs 1-5), which is less than the scape of D. bimaculatus with white upper surface (Fig. 9). Besides, molecular data support the separation of these two morphologically similar species as distinct species. Molecular identification results COI The length of COI sequences from 67 D. difasciatus specimens was 514 bp, including 35 variable sites with 20 parsimony-informative sites, and 29 haplotypes were found (Fig. 12). The highest percentage similarity (89%) of sequences between D. difasciatus and other Diglyphus species in the NCBI and BOLD databases was with D. pulchripes (Erdés & Novicky) (NCBI accession number: MG442711). The mean genetic distance of COI sequences between D. difasciatus/ D. bimacula- tus and D. difasciatus!D. isaea, based on the COI gene, was 11.33% and 13.37%, re- spectively (Table 3). The analyses of the intraspecific diversity in D. difasciatus showed that the mean genetic distance between the 29 haplotypes was 1.53% (Table 3). The genetic distance within D. difasciatus ranged from 0.19 to 3.42%. 74 Wei-Jie Wan et al. / ZooKeys 1148: 65-78 (2023) 1mm / 9 4imm Figures 9-10. Diglyphus bimaculatus 9 female habitus, lateral view 10 male habitus, dorsal view. ITS2 The length of the 25 D. difasciatus sequences was 415 bp; there were no variable sites. The highest percentage similarity of sequences in the NCBI and BOLD databases was between D. difasciatus and D. isaea (86%). The mean interspecific genetic distance be- tween D. difasciatus! D. bimaculatus and D. difasciatus/D. isaea was 8.62% and 6.49%, respectively (Table 3). 28S The length of the 11 sequences obtained from D. difasciatus was 547 bp; there were no variable sites. The highest percentage similarity of sequence in NCBI and BOLD be- tween D. difasciatus and other Diglyphus species was with D. crassinervis (100% [NCBI accession number: MW393686]). The mean interspecific genetic distance between D. difasciatus, D. bimaculatus and D. isaea was 0.18% (Table 3). All gene sequences are uploaded to GenBank with accession numbers OP933727- OP933732 and OP936054—OP936075. Table 3. The mean genetic distance between three Diglyphus species based on the COI, ITS2 and 28S genes. Species COI ITS2 28S 1 2 3 1 2} 3 1 2 3 1 OD. difasciatus 0.0153 - - 2 D.bimaculatus 0.1133 - 0.0862 - 0.0018 - 3 OD. isaea 0.1337 0.1485 = 0.0649 0.0414 - 0.0018 0.0037 a A new species of Diglyphus Walker from China ie, 70° E 80° E 90° E 100° E 110°E 120° E 130° E 140° E es YZ —] ° + =) + § Z m a mn Z| Z R z © Occurrence records 90° E 100° E 110° E 120° E Figure | 1. Collection sites of Diglyphus difasciatus sp. nov. in China from 2016 to 2022. bimaculatus OP936074 isaea OP936075 difasciatus Hap_27 OP936071 difasciatus Hap_22 OP936066 difasciatus Hap_26 OP936070 difasciatus Hap_25 OP936069 difasciatus Hap 21 OP936065 difasciatus Hap_24 OP936068 difasciatus Hap_29 OP936073 difasciatus Hap_23 OP936067 difasciatus Hap_28 OP936072 difasciatus Hap_1 OP936045 difasciatus Hap_9 OP936053 difasciatus Hap_11 OP936055 difasciatus Hap_12 OP936056 difasciatus Hap_8 OP936052 difasciatus Hap_18 OP936062 difasciatus Hap_16 OP936060 difasciatus Hap_10 OP936054 difasciatus Hap_19 OP936063 difasciatus Hap_13 OP936057 difasciatus Hap_17 OP936061 difasciatus Hap_7 OP936051 difasciatus Hap_15 OP936059 difasciatus Hap_3 OP936047 difasciatus Hap 20 OP936064 difasciatus Hap_4 OP936048 — difasciatus Hap_14 OP936058 difasciatus Hap_2 OP936046— difasciatus Hap_5 OP936049 © difasciatus Hap_6 OP936050 — 100 Tree scale 0.003 — DOSSESSVsSdsSppHpHyyysyydsdSdshSoyyyysd Figure | 2. Phylogenetic tree of the three Diglyphus species based on the COI gene. The phylogenetic tree was constructed using the maximum likelihood method based on the Neighbor-Joining model. Accession numbers submitted to GenBank are shown next to each haplotype, and bootstrap support values (2 75%) are shown next to the branches. 76 Wei-Jie Wan et al. / ZooKeys 1148: 65-78 (2023) Discussion The new species, D. difasciatus, is defined by morphological data and molecular data from the genes COI, ITS2, and 28S. Morphologically, D. difasciatus is most similar to D. bimaculatus, from which it can be separated by a different wing pattern in the fore wing and the color of scape (Figs 3, 7-9). Molecular data from COI, ITS2, and 28S also show that D. difasciatus and D. bimaculatus are two different species. Acknowledgments We thank Miao-Miao Mao for collecting material of the new species, and Editage (www. editage.cn) for English language editing. The present was supported by the National Natural Science Foundation of China (Grant No. 31772236 and No. 31972344), the National Key R&D Program of China (Grant No. 2021 YFC2600400) and the Science and Technology Innovation Program of Chinese Academy of Agricultural Sci- ences (Grant No. caascx-2017-2022-IAS) References Bader AE, Heinz KM, Wharton RA, Bogran CE (2006) Assessment of interspecific interac- tions among parasitoids on the outcome of inoculative biological control of leafminers attacking chrysanthemum. Biological Control 39(3): 441-452. https://doi.org/10.1016/j. biocontrol.2006.06.010 Bernardo U, Monti MM, Nappo AG, Gebiola M, Russo A, Pedata PA, Viggiani G (2008) Species status of two populations of Pnigalio soemius (Hymenoptera: Eulophidae) reared from two different hosts: An integrative approach. Biological Control 46(3): 293-303. https://doi.org/10.1016/j.biocontrol.2008.05.009 Burks RA, Heraty JM, Gebiola M, Hansson C (2011) Combined molecular and morpho- logical phylogeny of Eulophidae (Hymenoptera: Chalcidoidea), with focus on the subfamily Entedoninae. Cladistics 27(6): 581-605. https://doi.org/10.1111/j.1096- 0031.2011.00358.x Campbell BC, Steffen-Campbell JD, Werren JH (1993) Phylogeny of the Nasonia spe- cies complex (Hymenoptera: Pteromalidae) inferred from an internal transcribed spacer (ITS2) and 28S rDNA sequences. Insect Molecular Biology 2(4): 225-237. https://doi. org/10.1111/j.1365-2583.1994.tb00142.x De Barro PJ, Driver F (1997) Use of RAPD PCR to distinguish the B biotype from other biotypes of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Australian Journal of Entomology 36(2): 149-152. https://doi.org/10.1111/j.1440-6055.1997.tb01447.x Du SJ, Yefremova Z, Ye FY, Zhu CD, Guo JY, Liu WX (2021) Morphological and molecu- lar identification of arrhenotokous strain of Diglyphus wani (Hymenoptera, Eulophidae) found in China as a control agent against agromyzid leafminers. ZooKeys 1071: 109-126. https://doi.org/10.3897/zookeys. 107 1.72433 A new species of Diglyphus Walker from China fies Foba CN, Salifu D, Lagat ZO, Gitonga LM, Akutse KS, Fiaboe KKM (2016) Liriomyza leafminer (Diptera: Agromyzidae) parasitoid complex in different agroecological zones, sea- sons, and host plants in Kenya. Environmental Entomology 45(2): 357-366. https://doi. org/10.1093/ee/nvv218 Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299. Gauthier N, LaSalle J, Quicke DLJ, Godfray HCJ (2000) Phylogeny of Eulophidae (Hymenoptera: Chalcidoidea), with a reclassification of Eulophinae and the recognition that Elasmidae are derived eulophids. Systematic Entomology 25(4): 521-539. https://doi. org/10.1046/j.1365-3113.2000.00134.x Gebiola M, Bernardo U, Monti MM, Navone P, Viggiani G (2009) Pnigalio agraules (Walker) and Pnigalio mediterraneus Ferriere & Delucchi (Hymenoptera: Eulophidae): two close- ly related valid species. Journal of Natural History 43(39-40): 2465-2480. https://doi. org/10.1080/00222930903105088 Gebiola M, Gomez-Zurita J, Monti MM, Navone P, Bernardo U (2012) Integration of mo- lecular, ecological, morphological and endosymbiont data for species delimitation with- in the Pnigalio soemius complex (Hymenoptera: Eulophidae). Molecular Ecology 21(5): 1190-1208. https://doi.org/10.1111/j.1365-294X.2011.05428.x Gebiola M, Bernardo U, Ribes A, Gibson GAP (2015) An integrative study of Necremnus Thomson (Hymenoptera: Eulophidae) associated with invasive pests in Europe and North America: taxonomic and ecological implications. Zoological Journal of the Linnean Society 173(2): 352-423. https://doi.org/10.1111/zoj.12210 Gibson GAP (1989) Phylogeny and classification of Eupelmidae, with a revision of the world genera of Calosotinae and Metapelmatinae (Hymenoptera: Chalcidoidea). Memoirs of the En- tomological Society of Canada 121(S149): 1-149. https://doi.org/10.4039/entm121149fv Gordh G, Hendrickson Jr R (1979) New species of Diglyphus, a world list of the species, taxo- nomic notes, and a key to New World species of Diglyphus and Diaulinopsis (Hymenoptera: Eulophidae). Proceedings of the Entomological Society of Washington 81: 666-684. Hansson C (1990) A taxonomic study on the Palearctic species of Chrysonotomyia Ashmead and Neochrysocharis Kurdjumov (Hymenoptera: Eulophidae). Entomologica Scandinavica 21(1): 29-52. https://doi.org/10.1163/187631290X00021 Hansson C, Navone P (2017) Review of the European species of Diglyphus Walker (Hymenoptera: Eulophidae) including the description of a new species. Zootaxa 4269(2): 197-229. https://doi.org/10.11646/zootaxa.4269.2.2 Hebert P, Cywinska A, Ball S, Dewaard J (2003) Biological identifications through DNA bar- codes. Proceedings. Biological Sciences 270(1512): 313-321. https://doi.org/10.1098/ rspb.2002.2218 Kaspi R, Parrella MP (2006) Improving the biological control of leafminers (Diptera: Agromyzidae) using the sterile insect technique. Journal of Economic Entomology 99(4): 1168-1175. https://doi.org/10.1093/jee/99.4.1168 Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16(2): 111-120. https://doi.org/10.1007/BF01731581 78 Wei-Jie Wan et al. / ZooKeys 1148: 65-78 (2023) Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution 35(6): 1547-1549. https://doi.org/10.1093/molbev/msy096 Librado P, Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25(11): 1451-1452. https://doi.org/10.1093/bioinformatics/btp187 Liu WX, Wang WX, Wang W, Zhang YB, Wan FH (2013) Characteristics and application of Diglyphus parasitoids (Hymenoptera: Eulophidae: Eulophinae) in controlling the agro- myzid leafminer. Acta Entomologica Sinica 56: 427-437. [In Chinese] Nei M, Kumar S (2000) Molecular evolution and phylogenetics. Oxford University Press, New York, 333 pp. Noyes JS (2019) Universal Chalcidoidea Database. World Wide Web electronic publication. https://www.nhm.ac.uk/chalcidoids [Accessed September 2022] Rajender K, Sharma PL (2016) Studies on diversity and abundance of parasitoids of Chromatomyia horticola (Goureau) (Agromyzidae: Diptera) in north-western Himalayas, India. Journal of Applied and Natural Science 8(4): 2256-2261. https://doi-org/10.31018/jans.v8i4.1121 Walker F (1844) On the species of Chalcidites inhabiting the Arctic Region. Annals & Maga- zine of Natural History 14: 409. https://doi.org/10.1080/037454809495210 Ye FY, Zhu CD, Yefremova Z, Liu WX, Guo JY, Wan FH (2018) Life history and biocontrol potential of the first female-producing parthenogenetic species of Diglyphus (Hymenoptera: Eulophidae) against agromyzid leafminers. Scientific Reports 8(1): 3222. https://doi. org/10.1038/s41598-018-20972-3 Yefremova Z (2007) The subfamilies Eulophinae, Euderinae and Entedoninae (Hymenoptera: Eulophidae) in Yemen. Fauna of Arabia 23: 335-368. Yefremova Z, Civelek HS, Boyadzhiyev P, Dursun O, Eskin A (2011) A review of Turkish Diglyphus Walker (Hymenoptera: Eulophidae), with description of a new species. Annales de la Société Entomologique de France 47(3—4): 273-279. https://doi.org/10.1080/0037 9271.2011.10697720 Zhu CD, LaSalle J, Huang DW (2000) A review of the Chinese Diglyphus Walker (Hymenoptera: Eulophidae). Oriental Insects 34(1): 263-288. https://doi-org/10.1080/00305316.2000. 10417266 Supplementary material | The genetic distance between three Diglyphus species based on the COI gene Authors: Wei-Jie Wan, Su-Jie Du, Christer Hansson, Wan-Xue Liu Data type: phylogenetic Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODDbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1148.98853.suppl1